Review



addgene cat 110164 software  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Addgene inc addgene cat 110164 software
    Addgene Cat 110164 Software, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 15 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/px458+ruby/pX458_Ruby+(Plasmid+%23110164)/pm41734765-267-241-241
    Average 93 stars, based on 15 article reviews
    addgene cat 110164 software - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: GTP Cyclohydrolase Drives Breast Cancer Development and Promotes EMT in an Enzyme-Independent Manner
    Article Snippet: GTP cyclohydrolase (GCH1) is the rate-limiting enzyme for tetrahydrobiopterin (BH4) biosynthesis.. The catalysis of BH4 biosynthesis is tightly regulated for physiological neurotransmission, inflammation, and vascular tone.. Paradoxically, BH4 has emerged as an oncometabolite regulating tumor growth, but the effects on tumor development remain controversial.

    Article Title: Annexin A2 mediates RIG-I-like receptor responses to viral infection
    Article Snippet: THP1 cells were differentiated into macrophage-like cells prior to experiments by 24 h treatment with 10 ng/ml phorbol myristate acetate (PMA; Invivogen). .. For generation of ANXA2 knockout cells using CRISPR/Cas9 technology, two sgRNAs targeting upstream and downstream of exon 2 of the human ANXA2 gene were cloned into either pX458-eGFP or pX458-Ruby (Addgene 110164, deposited by Dr. Philip Hublitz), as described previously ( ). .. LTX Transfection kit (ThermoFisher) was used to transfect 4 x 10 6 THP1 cells with 10 μg of both plasmids, or 7 x 10 5 A549 or p125HEK cells with 1 μg of both plasmids according to manufacturer’s instructions.

    Article Title: Diffusion and interaction dynamics of the cytosolic peroxisomal import receptor PEX5
    Article Snippet: .. In particular, the sgRNA pairs targeted defined critical exons of PEX5 (exon 2) and PEX14 (exon 3), resulting in nonsense-mediated mRNA decay (NMD), the likely event after homozygous deletion in both cases. sgRNAs were selected using the CRISPOR algorithm ( ). sgRNAs targeting the intron upstream of the respective splice branch point were cloned into pX458 (Addgene 48138, Dr. Feng Zhang), and sgRNAs targeting the intron downstream of the target exon were cloned into pX458-Ruby (Addgene 110164, Dr. Philip Hublitz). sgRNA ON-target efficiency was evaluated by Surveyor assay (Surveyor Mutation Detection Kit, IDT) and the following guides were chosen: PEX14 5’: GGatcagctcgaatggagatc, PEX14 3’: GGaccccccagtggggcatgc; PEX5 5’: ggggtcgcagcaaaagcact, and PEX5 3’: Ggtttataaacgctcagtaag (capitalized nucleotides within the sgRNA sequences correspond to added G residues to allow for proper pol III transcription). ..

    Article Title: Super-enhancers require a combination of classical enhancers and novel facilitator elements to drive high levels of gene expression
    Article Snippet: Candidates with the fewest predicted off-targets were selected and further screened for their effectiveness, using an in vitro surveyor assay (according to the manufacturer, IDT). .. For enhancer deletion, gRNAs were designed flanking the targeted enhancer, and cloned into pSpCas9 (BB)-2A-GFP (pX458) vector, a gift from Feng Zhang (Addgene plasmid: #48138), or pX458-ruby ( )). .. Hemizygous WT mESCs were co-transfected, by lipofection, with the appropriate 5’ targeting vector (expressing GFP) and 3’-targeting vector (expressing mRuby), and 24-36 hours later, GFP-mRuby co-fluorescent cells were FACS sorted into individual wells of a 96 well plate.

    Article Title: Diffusion and interaction dynamics of the cytosolic peroxisomal import receptor PEX5
    Article Snippet: .. In particular, the sgRNA pairs targeted defined critical exons of PEX5 (exon 2) and PEX14 (exon 3), resulting in nonsense-mediated mRNA decay, the likely event after homozygous deletion in both cases. sgRNAs were selected using the CRISPOR algorithm ( ). sgRNAs targeting the intron upstream of the respective splice branch point were cloned into pX458 (Addgene 48138, Dr. Feng Zhang), and sgRNAs targeting the intron downstream of the target exon were cloned into pX458-Ruby (Addgene 110164, Dr. Philip Hublitz). sgRNA ON-target efficiency was evaluated by Surveyor assay (Surveyor Mutation Detection Kit; IDT, Coralville, IA), and the following guides were chosen: PEX14 5′, GGatcagctcgaatggagatc; PEX14 3′, GGaccccccagtggggcatgc; PEX5 5′, ggggtcgcagcaaaagcact; PEX5 3′, Ggtttataaacgctcagtaag (capitalized nucleotides within the sgRNA sequences correspond to added G residues to allow for proper polymerase III transcription). ..

    Article Title: ATRX loss couples genome instability at a G-rich repeat to dysregulation of human alpha-globin expression.
    Article Snippet: .. The dual gRNAs were cloned into the pX458-eGFP (Addgene 48138) and pX458-Ruby (Addgene 110164) plasmids respectively, and 2.5 μg of each was cotransfected into 2 x 106 ATRX degron cells using the same nucleofection protocol as described above. ..

    Article Title: ATRX loss couples genome instability at a G-rich repeat to dysregulation of human alpha-globin expression
    Article Snippet: .. The dual gRNAs were cloned into the pX458-eGFP (Addgene 48138) and pX458-Ruby (Addgene 110164) plasmids respectively, and 2.5 μg of each was co-transfected into 2 × 10 6 ATRX degron cells using the same nucleofection protocol as described above. ..

    Activity Assay:

    Article Title: Unexpectedly High Levels of Inverted Re-Insertions Using Paired sgRNAs for Genomic Deletions
    Article Snippet: .. Individual ssODNs for sgRNA pairs were subcloned into pX458-eGFP (Addgene 48138) and pX458-Ruby (Addgene 110164) and ON-target activity of each individual sgRNA was evaluated by Surveyor assays (according to the manufacturer, IDT). ..

    Knock-Out:

    Article Title: Annexin A2 mediates RIG-I-like receptor responses to viral infection
    Article Snippet: THP1 cells were differentiated into macrophage-like cells prior to experiments by 24 h treatment with 10 ng/ml phorbol myristate acetate (PMA; Invivogen). .. For generation of ANXA2 knockout cells using CRISPR/Cas9 technology, two sgRNAs targeting upstream and downstream of exon 2 of the human ANXA2 gene were cloned into either pX458-eGFP or pX458-Ruby (Addgene 110164, deposited by Dr. Philip Hublitz), as described previously ( ). .. LTX Transfection kit (ThermoFisher) was used to transfect 4 x 10 6 THP1 cells with 10 μg of both plasmids, or 7 x 10 5 A549 or p125HEK cells with 1 μg of both plasmids according to manufacturer’s instructions.

    CRISPR:

    Article Title: Annexin A2 mediates RIG-I-like receptor responses to viral infection
    Article Snippet: THP1 cells were differentiated into macrophage-like cells prior to experiments by 24 h treatment with 10 ng/ml phorbol myristate acetate (PMA; Invivogen). .. For generation of ANXA2 knockout cells using CRISPR/Cas9 technology, two sgRNAs targeting upstream and downstream of exon 2 of the human ANXA2 gene were cloned into either pX458-eGFP or pX458-Ruby (Addgene 110164, deposited by Dr. Philip Hublitz), as described previously ( ). .. LTX Transfection kit (ThermoFisher) was used to transfect 4 x 10 6 THP1 cells with 10 μg of both plasmids, or 7 x 10 5 A549 or p125HEK cells with 1 μg of both plasmids according to manufacturer’s instructions.

    Mutagenesis:

    Article Title: Diffusion and interaction dynamics of the cytosolic peroxisomal import receptor PEX5
    Article Snippet: .. In particular, the sgRNA pairs targeted defined critical exons of PEX5 (exon 2) and PEX14 (exon 3), resulting in nonsense-mediated mRNA decay (NMD), the likely event after homozygous deletion in both cases. sgRNAs were selected using the CRISPOR algorithm ( ). sgRNAs targeting the intron upstream of the respective splice branch point were cloned into pX458 (Addgene 48138, Dr. Feng Zhang), and sgRNAs targeting the intron downstream of the target exon were cloned into pX458-Ruby (Addgene 110164, Dr. Philip Hublitz). sgRNA ON-target efficiency was evaluated by Surveyor assay (Surveyor Mutation Detection Kit, IDT) and the following guides were chosen: PEX14 5’: GGatcagctcgaatggagatc, PEX14 3’: GGaccccccagtggggcatgc; PEX5 5’: ggggtcgcagcaaaagcact, and PEX5 3’: Ggtttataaacgctcagtaag (capitalized nucleotides within the sgRNA sequences correspond to added G residues to allow for proper pol III transcription). ..

    Article Title: Diffusion and interaction dynamics of the cytosolic peroxisomal import receptor PEX5
    Article Snippet: .. In particular, the sgRNA pairs targeted defined critical exons of PEX5 (exon 2) and PEX14 (exon 3), resulting in nonsense-mediated mRNA decay, the likely event after homozygous deletion in both cases. sgRNAs were selected using the CRISPOR algorithm ( ). sgRNAs targeting the intron upstream of the respective splice branch point were cloned into pX458 (Addgene 48138, Dr. Feng Zhang), and sgRNAs targeting the intron downstream of the target exon were cloned into pX458-Ruby (Addgene 110164, Dr. Philip Hublitz). sgRNA ON-target efficiency was evaluated by Surveyor assay (Surveyor Mutation Detection Kit; IDT, Coralville, IA), and the following guides were chosen: PEX14 5′, GGatcagctcgaatggagatc; PEX14 3′, GGaccccccagtggggcatgc; PEX5 5′, ggggtcgcagcaaaagcact; PEX5 3′, Ggtttataaacgctcagtaag (capitalized nucleotides within the sgRNA sequences correspond to added G residues to allow for proper polymerase III transcription). ..

    Plasmid Preparation:

    Article Title: Super-enhancers require a combination of classical enhancers and novel facilitator elements to drive high levels of gene expression
    Article Snippet: Candidates with the fewest predicted off-targets were selected and further screened for their effectiveness, using an in vitro surveyor assay (according to the manufacturer, IDT). .. For enhancer deletion, gRNAs were designed flanking the targeted enhancer, and cloned into pSpCas9 (BB)-2A-GFP (pX458) vector, a gift from Feng Zhang (Addgene plasmid: #48138), or pX458-ruby ( )). .. Hemizygous WT mESCs were co-transfected, by lipofection, with the appropriate 5’ targeting vector (expressing GFP) and 3’-targeting vector (expressing mRuby), and 24-36 hours later, GFP-mRuby co-fluorescent cells were FACS sorted into individual wells of a 96 well plate.



    Similar Products

    93
    Addgene inc addgene cat 110164 software
    Addgene Cat 110164 Software, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/px458+ruby/pX458_Ruby+(Plasmid+%23110164)/pm41734765-267-241-241
    Average 93 stars, based on 1 article reviews
    addgene cat 110164 software - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc px458 ruby plasmid
    Px458 Ruby Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/px458+ruby/pX458_Ruby+(Plasmid+%23110164)/pm41688464-235-35-37
    Average 93 stars, based on 1 article reviews
    px458 ruby plasmid - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc px458 ruby
    Px458 Ruby, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/px458+ruby/pX458_Ruby+(Plasmid+%23110164)/pmc13018553-277-11-12
    Average 93 stars, based on 1 article reviews
    px458 ruby - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc cas9 guide plasmids
    Cas9 Guide Plasmids, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/px458+ruby/pX458_Ruby+(Plasmid+%23110164)/pm41197626-329-16-21
    Average 93 stars, based on 1 article reviews
    cas9 guide plasmids - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc psptcas9 bb 2a puro px459 addgene
    Psptcas9 Bb 2a Puro Px459 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/px458+ruby/pX458_Ruby+(Plasmid+%23110164)/pm41197626-271-215-217
    Average 93 stars, based on 1 article reviews
    psptcas9 bb 2a puro px459 addgene - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc px458 egfp
    Px458 Egfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/px458+ruby/pX458_Ruby+(Plasmid+%23110164)/bio_rxiv__2025__10__28__684968-206-27-30
    Average 93 stars, based on 1 article reviews
    px458 egfp - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    90
    Addgene inc px458-ruby
    Px458 Ruby, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/px458+ruby/pspcas9+bb++2a+gfp++px458+/pmc10858684-396-21-17
    Average 90 stars, based on 1 article reviews
    px458-ruby - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results